产品描述信息
MRA-132B??Anopheles gambiae, G3, Bulk Frozen(Vectors)|Anopheles gambiae|G3, Bulk Frozen|-80°C|MQ BenedictAcknowledgment for publications should read "The following reagent was obtained through BEI Resources, NIAID, NIH: Anopheles gambiae, Strain G3, Bulk Frozen, MRA-132B, contributed by Mark Q. Benedict."|Quantity limit per order for this item is 1. This item can be ordered twice a year. Orders over this limit will be sent to NIAID for approval before shipment.Anopheles gambiae (A. gambiae) G3 stock was identified to species according to morphologic criteria (wild eye color, polymorphic at collarless). A sample of 100 individuals is 100% susceptible to dieldrin at 1 ppm for 1 hour in the fourth stage. When PCR amplified with ribosomal DNA 28S 'universal' primer (GTGTGCCCCTTCCTCGATGT) and an equimolar combination of A. gambiae- and A. arabiensis-specific primers (CTGGTTTGGTCGGCACGTTT and AAGTGTCCTTCTCCATCC TA, respectively), the rDNA IGS region yields a 390-bp fragment as determined by agarose gel electrophoresis. G3 is a mongrel stock that has not been exhaustively defined and has no authentication standards that definitively distinguish it from several other 'wild' A. gambiae stocks. It is distributed 'as is' with accompanying authentication information. Its generally good vigor and 'wild', but polymorphic, nature are its chief virtues.MRA-132B contains approximately 200 unsexed, adult wild-type A. gambiae, strain G3 mosquitoes, which were preserved in liquid nitrogen (quick-frozen) while alive. MRA-132B is suitable for DNA and RNA isolation, protein extraction, etc.