产品描述信息
MRA-199?? Plasmid FR-3D7, for Transfection in Plasmodium falciparum, Recombinant in Escherichia coli(Plasmid/Vectors)|Plasmodium falciparum|Plasmid FR-3D7, for Transfection in Plasmodium falciparum, Recombinant in Escherichia coli|4°C|CV PloweAcknowledgment for publications should read "The following reagent was obtained through BEI Resources, NIAID, NIH: Plasmid FR-3D7, for Transfection in Plasmodium falciparum, Recombinant in Escherichia coli, MRA-199, contributed by Christopher V. Plowe."|Quantity limit per order for this item is 1. This item can be ordered twice a year. Orders over this limit will be sent to NIAID for approval before shipment. This reagent was authenticated by the contributor. BEI Resources has not confirmed or validated this material.Dihydrofolate reductase (DHFR) from Plasmodium falciparum (P. falciparum), strain SL/D6 (pyrimethamine-sensitive) was amplified by primers FRY-71 (CGGGATCC TATGATGGAACAAGTCTGCG) and FRY-86 (GCGCGGCCGTCATATGACATGTATCTT). Note: The SL/D6 (pyrimethamine-sensitive) strain of P. falciparum has the same DHFRTS genotype as the 3D7 strain. Plasmid FR-3D7 has been submitted to serve as a control in allele-specific PCR for the analysis of mutations in P. falciparum DHFR. The relevant 3D7 DHFR genotype is as follows: 16A 50C 51N 59C 108S 164I. The resulting size of the plasmid is 6.508 kilobases.Each vial of MRA-199 contains plasmid FR-3D7 in recombinant freeze-dried E. coli. Plowe, C. V., et al. "Mutations in Plasmodium falciparum Dihydrofolate Reductase and Dihydropteroate Synthase and Epidemiologic Patterns of Pyrimethamine-Sulfadoxine Use and Resistance." J. Infect. Dis. 176 (1997): 1590-1596. PubMed: 9395372.Wooden, J. M., et al. "Analysis in Yeast of Antimalaria Drugs that Target the Dihydrofolate Reductase of Plasmodium falciparum." Mol. Biochem. Parasitol. 85 (1997): 25-40. PubMed: 9108546.Cortese, J. F. and C. V. Plowe. "Antifolate Resistance Due to New and Known Plasmodium falciparum Dihydrofolate Reductase Mutations Expressed in Yeast." Mol. Biochem. Parasitol. 94 (1998): 205-214. PubMed: 9747971.